Tag der Freiheit: „BILD“-Zeitung entsetzt, „Rote Fahne“ begeistert

23

Nach dem „Tag der Freiheit“ am vergangenen Wochenende in Berlin versuchen die Massenmedien und der öffentlich-rechtliche Staatsfunk weiterhin, die Deutungshoheit über die Ereignisse zurückzuerobern. Einige Medien gehen sogar so weit, der von der Politik ins Gespräch gebrachten Beschneidung der Versammlungsfreiheit zuzustimmen, hier erheben sich aber auch Gegenstimmen. Lesen Sie jetzt in unserem Sonderheft Corona: Was uns der Staat verschweigt die Fakten, die andere unterdrücken.

 Franz Josef Wagner ist der Mann fürs Grobe bei der Bild. So verwundert es auch kaum, dass er nach der Mega-Demo am Wochenende ran musste, um gegen die Lockdown-Kritiker zu schießen. In seiner gestrigen Kolumne führte er aus: „Was für eine schreckliche Demonstration. Gute Menschen, böse Menschen, alle ohne Maske. Zwanzigtausend solcher Menschen demonstrierten. Die Polizei löste die Demonstration auf. Nächste Woche werden wir erfahren, wie viele Menschen infiziert wurden, wie viele gestorben sind. Wenn man sich fragt, was gefährlicher ist, eine Schusswaffe oder die Dummheit? Dann sage ich: die Dummheit.“

„Regenbogenfahnen neben der Fahne des Kaiserreichs“

Im Vergleich mit dem Rundumschlag Wagners liest sich der Kommentar von Bild-Chefredakteur Julian Reichelt dann deutlich differenzierter – offensichtlich weiß dieser noch, das auch ein nicht gerade kleiner Teil der eigenen Leserschaft die Lockdown-Maßnahmen kritisch sieht. In seinem am 2. August erschienenen Beitrag „Warum Corona für die Politik genauso gefährlich ist wie für unsere Gesundheit!“ schreibt er: „Auf einer der irrsinnigsten Demos der deutschen Geschichte wehen in Berlin Regenbogenfahnen neben der bei Neonazis beliebten Fahne des Kaiserreichs (Schwarz-Weiß-Rot, auch die Farben der Nazis). Grüne Studienräte marschieren neben Hakenkreuztattoos. Friedensbewegte und Profisportler mit dunkler Hautfarbe in Rufweite von Rechtsextremen. Menschen ohne Maske demonstrieren gegen eine ,Maskendiktatur‛, die sie freundlich gegen jede Regel verstoßen lässt, während die Polizei auf Twitter behauptet, man dulde keine Regelverstöße. […] Was mich sorgt: Das politische Klima wird immer irrationaler, irrsinniger und feindseliger – und das, obwohl Sommerferien sind, das Wetter schön ist und Millionen Menschen (fast) voll bezahlt frei haben. Aber man spürt bei vielen bereits die Sorge und die Gereiztheit der aufziehenden Rezession.“

»Schlimmer als die Zensur der Presse ist die Zensur durch die Presse.«, schrieb der hellsichtige Gilbert K. Chesterton – Schöpfer der weltbekannten Figur Pater Brown – bereits Anfang des vorigen Jahrhunderts. Chesterton, der journalistische Star seiner Zeit, katholischer Konvertit, ist das Vorbild für Matusseks Bericht aus dem Innenraum der Vierten Gewalt. Denn die Medien haben sich in den letzten Jahren in einen unkritischen Jubelchor der Regierung verwandelt und das Land in einen Hippiestaat, der so verrückt agiert, als gäben die Woodstock-Veteranen Jefferson Airplane mit ihrer psychedelischen Hymne »White Rabbit« den Takt vor. So hält uns der Autor Matthias Matussek Glanz und Elend des heutigen Journalismus vor Augen: mitreißend, radikal subjektiv, schonungslos, umwerfend komisch. HIER bestellen oder zum bestellen auf das Banner oben klicken!

Ein ganz offener Aufruf zu einer weitgehenden Beschneidung der Versammlungsfreiheit kommt hingegen von Eva Quadbeck, der stellvertretenden Chefredakteurin der Rheinischen Post, also der auflagenstärksten Tageszeitung in Nordrhein-Westfalen. In ihrem heute erschienenen Kommentar „Gefährliche Corona-Mischung“ schreibt sie: „Wenn bislang demonstriert wurde, waren die Protestler für mehr Klimaschutz, gegen ein Handelsabkommen, für bezahlbaren Wohnraum oder ein anderes konkretes Anliegen. Neu aber ist, dass eine Mischung aus Rechts- und Linksradikalen, aus Reichsbürgern und Normalbürgern, die nicht einsehen, einen Mund-Nasen-Schutz zu tragen, aus ganz Deutschland nach Berlin reisten und sich für das Ende einer Pandemie ausspricht. Nun kann man ja bekanntlich eine Pandemie nicht für beendet erklären, da ein Virus noch weniger rationales Einsehen hat als ein Demonstrant, der gegen die Existenz des Virus protestiert. […] Dass die Polizei in Berlin dabei mit Umsicht vorgeht und gewaltsame Auseinandersetzungen vermeidet, ist grundsätzlich richtig. Dennoch sollten Kundgebungen, bei denen behördliche Auflagen massenhaft und stundenlang missachtet werden, künftig unterbunden werden. Die Verantwortung dafür trägt nicht alleine die Polizei.“

„Politik darf nicht mit zweierlei Maß messen“

Im Handelsblatt macht Martin Greive heute hingegen auf den Umstand aufmerksam, dass Verletzungen der Abstands- und Maskenschutzpflichten völlig unterschiedlich bewertet werden, je nachdem, aus welcher politischen Ecke sie kommen. In seinem Kommentar „Sägen an der Freiheit“ stellt er fest: „So waren die Rufe nach einem Versammlungsverbot nach der ,Black-Lives-Matter‛-Kundgebung Anfang Juni bei Weitem nicht so laut wie jetzt. Damals benahmen sich die Demonstranten zwar auch nicht daneben. Doch auch diese Kundgebung war aus Infektionsschutz-Sicht problematisch. Die Politik darf aber nicht mit zweierlei Maß messen, nur weil die einen für eine vermeintlich gute Sache und die anderen gegen die eigenen Maßnahmen demonstrieren.“

Uneingeschränkt positiv berichtete hingegen die kommunistische Rote Fahne. Auf den Netzseiten der Organisation war zu lesen: „Demokratiebewegung: 1,2 Millionen in Berlin auf den Straßen! Das Corona-Regime muss fallen! Regime lässt Bühne durch Polizei stürmen.“ Weiter stellt die kommunistische Online-Zeitung fest: „Um aber das Regime stürzen zu können, bedarf es drei zentraler Voraussetzungen: 1. Arbeiter- und Volksräte in den Städten. 2. Programm der nationalen Einheit. 3. Regierung der nationalen Einheit“.

Fakten gegen die Hysterie: In unserer Sonderausgabe COMPACT-Aktuell „Corona – Was uns der Staat verschweigt“ lassen wir Experten wie den Lungenarzt Dr. Wolfgang Wodarg, den Epidemiologen Prof. Sucharit Bhakdi oder die Virologin Prof. Dr. Karin Mölling zu Wort kommen, deren Argumente in der öffentlichen Debatte unter den Tisch fallen. Wir zeigen auf, wie die Corona-Maßnahmen der Bundesregierung unsere Freiheit, unsere Bürgerrechte und unsere Wirtschaft gefährden. Neben einem faktenreichen Kapitel über Biowaffen finden Sie in dem Heft außerdem ein großes Interview mit dem Ökonomen Dr. Markus Krall und aufschlußreiche Beiträge über die Interessen der Pharmaindustrie und der WHO. Geballtes Wissen auf 84 Seiten. Zur Bestellung HIER oder auf das Bild unten klicken.

Über den Autor

Avatar

23 Kommentare

  1. Avatar
    Werner Holt am

    Wagner: "Zwanzigtausend solcher Menschen demonstrierten. (…) Nächste Woche werden wir erfahren, wie viele Menschen infiziert wurden, wie viele gestorben sind."

    – – –

    Was machen die, wenn es 30.000 Neuinfizierte aus den Reihen der Demo-Teilnehmer wären?! Nur mal so spekulativ.

    Besagte Verschwörungstheoretiker sprechen ja von mehr als einer Million Teilnehmer in Berlin. Eine Million und eine völlig überforderte Polizei. Diese eine Million hätte locker zum Reichstag durchmarschieren können, um diesen einfach mal so zu besetzen! Eine Million! – Denen "da oben" ging der Arsch spätestens am Sonnabend in Berlin blank auf Grundeis. – Wetten, daß sowas demnächst verboten wird?!

  2. Avatar

    Bevormundet werden will keiner wirklich! Weder ein Linker noch ein Rechter noch ein Sektirer oder Aluhutträger! Macht hat man aber dann, wenn man anderen Leuten vorschreiben kann, was sie zu tun und zu lassen haben! Und daran haben manche Leute eben den meisten Spaß und streben politische Ämter / Berufe an, wo sie diesen Spaß haben können!
    Warum – um alles in der Welt – können die Menschen nicht selbst entscheiden, ob sie sich vor einem Virus schützen wollen, oder nicht! Wenn manche Leute unbedingt 100 werden wollen, sollen sie es tun, aber nicht Anderen einreden, daß sie es auch unbedingt machen müssen und wenn die nicht wollen, sie dazu zwingen!!!
    Kinder und Jugendliche werden werweiswie eingeschränkt, werden sich mit Spucklappen im Gesicht weniger am Unterricht beteiligen, weil das Ding beim Reden lästig ist und werden durch Corona nicht krank! Da muß man nicht einzelne Ausnahmen vor die Nase hängen – Ausnahmen gibt es überall! – um den Blödsinn akzeptabel zu machen! Und alte Leute verkaften die soziale Isolation durch einen Lockdown noch schlechter als das Virus wenn sie schlank sind! Also laßt sie selber entscheiden!
    Die 1.Regel der Menschen im Umgang untereinander sollte heißen: DU SOLLST KEINEN ZWANG AUSÜBEN!!!

    • Avatar

      Stimmt. Niemand hat Boch auf Bevormundung.
      Schade nur das sich nicht noch mehr Leute gegen die Maßnahmen der Regierung auf die Straße trauen. Zumal die Demos allein nicht viel ändern werden; man braucht auch kreative Protestaktionen, wie man sie von der Identitären Bewegung kennt. Über diese ist übrigens vor Kurzem ein neues Buch erschienen: Christian-Schwochert/Angeklagt-Die-Identit%C3%A4re-Bewegung
      Schade nur das man von der IB nicht mehr so viel hört; die müssten auch mal wieder was machen.

    • Avatar

      Livia,
      ich schätze Ihre Kommentare im allgemeinen.
      Zu Corona will ich mich nicht äußern, bin kein Experte. Aber einen Einwand habe ich: mit dem Spucklappen schützt man nicht sich selber, sondern man schützt andere vor sich. Von daher ist eine freie Entscheidung, ihn zu tragen oder auch nicht, etwas delikat.

    • Avatar

      Als Raucher muss ich mich auch der Regel beugen in öffentlichen Räumen, Restaurants, Kneipen… nicht zu rauchen. Eine dauerhafte Einschränkung meiner Freiheit die ich akzeptiere, da ich dadurch die Gesundheit Anderer nicht beeinträchtige! Es ist und bleibt aber Zwang!
      Das Tragen der Alltagsmasken ist eine temporäre Massnahme um die Gesundheit Anderer durch das Virus nicht zu gefährden. Ebenfalls Zwang!
      Ich trage die Maske und erwarte Gleiches von allen Anderen zum Wohle der Allgemeinheit. Wir alle müssen mit Zwängen leben.

  3. Avatar

    Warnung !

    Unsere Regierung bereitet einen unvorstellbaren Massenmord an uns vor. Viele Pflegefälle wurden schon per Quarantäne indirekt ermordet und das sogar straffrei.
    Das macht den Psychopathen in der Regierung Lust auf mehr.

    Geplant ist eine Medikamentenstudie mit RNA-Impfstoffen an uns, die uns genetisch Verändern. Viele von uns werden daran qualvoll versterben.

    Schon mal kamen 50 Millionen Menschen durch eine Massenimpfung um, wurde aber der spanischen Grippe in die Schuhe geschoben.

    Außerdem wird in den Impfstoffen das krebsverursachende Enzym namens Nagalase hinzugefügt.Nagalase ist ein Enzym, das die Produktion von Vitamin D verhindert, was wiederum dem Körper die Möglichkeit nimmt, Krebszellen auf natürliche Weise zutöten.

    Desweiteren wird die Aluminiumdosis in den Impfstoffen erhöht, Aluminium greift das Gehirn an und wir verblöden.

    Impfstoffe bieten so vielfältige Möglichkeiten für die herrschende Klasse, um sie als Waffe gegen das Volk einzusetzen. Und darauf werden sie nicht verzichten.

    Wir das Volk, kämpfen von jetzt an um das nackte Überleben.

    Deshalb, informiert so viele wie möglich, Flyer in Briefkästen, an Häuserwände oder in die öffentlichen Verkehrsmittel.

    • Avatar

      @HANS2, ,,Halte die Menschheit unter 500 Millionen……. mit gemäßigter Vernunft"
      (Eine der 10 Inschriften/Ansagen der im Bundesstaat Georgia USA, anonym errichteten
      "Guidestones")

      Was soll dann aus den restlichen 6,5 Milliarden Menschen werden ? Die "Guidestones" geben darauf keine Anwort. Die anonymen Auftraggeber des Megalith-Monuments haben sicher eine Antwort.

  4. Avatar

    Brot für Die Rote Fahne!

    Ein Slogan von denen: "Frieden, Freiheit, Brot!" Moderner geht das ja nicht. Brot? Ja Brot, alles Streben fokussiert sich in Deutschland darauf. Mehr braucht es nicht, für einen anständigen deutschen Proletarier, wenn er noch Frieden und "Freiheit" dazu hat. Wer sich so auskennt, sollte Vorzeige-Kommunist und oberster Soviet in Deutschland sein. Gut dass Compact die nun protegiert, damit sie sich auch was zu Essen kaufen können.

    Wofür steht die Kommunistische Partei der Russischen Förderation eigentlich derzeit? Für die soziale Marktwirtschaft nach dem Vorbild Deutschlands. So jedenfalls deren Präsidentschaftskandidat Pawel Nikolajewitsch Grudinin laut Junge Welt. Wir Deutschen sind demnach, wer hätte es gedacht, mehrheitlich Kommunisten. Und wenn wir ein Problem nicht haben, dann sind es zu wenig Brotsorten, man bekommt es sogar Glutenfrei. Der Beweis ist geführt, der Kommunismus hat gesiegt. Den Wohlstand sollten wir dringend anders exportieren, als über die EU nach Oben zu verteilen, damit das Kapital nicht noch mehr Flüchtlinge produziert und uns alle gegeneinander ausspielt. Also sollte es doch besser heißen: Brot für die Welt! Statt albernes Gedönse mit roten Fähnchen….

  5. Avatar
    Das Sprachrohr der politischen Machthaber am

    Die Aufmachung von solchen systemtreuen Zeitungen war und ist immer das gleiche, nur gegen andere hetzen und das mit großer Schrift auf der ersten Seite. Völkischer Beobachter Neues Deutschland und BILD dich Blöd !

  6. Avatar

    PCR Test

    Auf Seiten des RKI steht zum Testverfahren PCR folgende(r) Empfehlung/Hinweis:

    "Von einer ungezielten Testung von asymptomatischen Personen wird aufgrund der unklaren Aussagekraft eines negativen Ergebnisses (lediglich Momentaufnahme) in der Regel abgeraten."

    Dieses verwundert nicht.

    1. Ohne Krankheitsausbruch werden die Viren i.d.R. nur in den tieferen Bereichen der Atemwege zu finden sein. Eine Prüfung im Mundraum ist hier nicht ausreichend ( RKI Hinweis: "Bei Verdacht auf das Vorliegen einer Infektion mit dem neuartigen Coronavirus (SARS-CoV-2) sollten je nach klinischer Situation möglichst Proben parallel aus den oberen und den tiefen Atemwegen entnommen werden")

    2. Beim PCR Test ist das Vergleichsmittel der "Primer". Dieser sitzt am Anfang oder Ende der RNS und spiegelt nur einen Teil der DNS wieder. Am Ende besagt der Test also nur, dass ein Virus X vorliegt oder nicht.

    • Avatar

      Hinweis eines Test-Herstellers: "SARS-CoV-2 weist eine 95%ige Homologie zu SARS-Viren auf, wodurch ein hohes Risiko für Kreuzreaktivität besteht."

      Im folgendem die DNS Struktur der Primer eines Herstellers und die ?vermuteten? RNS Anfänge Ende Covid-19:

      Forwardprimer: GCTGTGTGTTTGCCTATGTTGG Cov – 2 (Hersteller X)
      GACCCCAAAATCAGCGAAAT Covid-19 (1.Test)
      TTACAAACATTGGCCGCAAA Covid-19 (2.Test)

      Rewardprimer: ACGTTCACGACTCAGTATCTCAAG Cov-2 (Hersteller X)
      TCTGGTTACTGCCAGTTGAATCTG Covid-19 (1.Test)
      GCGCGACATTCCGAAGAA Covid-19 (2.Test)

      C = Cytosin, G = Guanin, A = Adenin, T = Thymin

      Wie man sieht weichen 1. Test und 2. Test auf Covid-29 deutlich ab.

      P.s.Der Coronavirus wird mit 30kb also 30000 Basenpaaren angegeben.

  7. Avatar
    DerSchnitter_Maxx am

    Nichtznutzige, nutzlose, überflüssige, Regime-Schmierenblätter … alle wie sie da sind – sonst nix 😉

  8. Avatar

    Da brat mir einer einen Storch.

    Hätte mir nie träumen lassen, mal den Kommunisten uneingeschränkt zu zustimmen

  9. Avatar

    Die Lügenpresse kann man leicht beseitigen, aber den völlig verfilzten Öffentlichen unrecht lichen Absahnerfunk wird man nur los, wenn man die Alt-Parteien Verräter losgeworden ist.
    Wir brauchen die Sammelklage damit den Vollkopferten das ungehemmte kassieren verleidet wird.

  10. Avatar
    HEINRICH WILHELM am

    Dass die Springerpresse (oder was davon noch "Springer" ist) sich hochnäsig, im Besitz der "Wahrheit" und auf Seiten der Mächtigen wähnt, dürfte nicht neu sein. Worüber ich immer wieder staune, ist, dass diese Art tastaturbewehrter Heckenschützen und Meinungswegelagerer den Schuss nicht hören wollen. Dagegen gibt sich das, ebenfalls regierungsnahe, Handelsblatt ja recht einsichtig.
    Nun ja: Die Rote Fahne. Das hier Zitierte liest sich, wie im Jahre 1919 geschrieben und zeugt entweder vom Abkupfern alter Vorlagen oder vom tatsächlichen Stehenbleiben im damaligen Revoluzzerdenken. Unterstellt man echtes Bemühen, so muss solchen "Ratschlägen" erst einmal das vorausgehen, was zu jeder Entschlussfassung gehört. Und dazu gehört a priori eine grundlegende und realistische Analyse der >gegenwärtigen< Lage.
    Dennoch: Interessanter Vergleich.

  11. Avatar

    "Gossen-Goethe" für diese senile alte xxxxx ist viel zu geschmeichelt, dieser verkommene xxxxx Wagner ist an Ehrlosigkeit nur noch mit Karl-Eduard von Schnitzler vergleichbar, jedoch intellektuell auf dem Niveau einer Amöbe.

    Wenn Spinger eine Kloake ist, dann ist die Bild ein Sondermüll-Lager und dieser Wagner xxxxxxxxxx

    Die offenkundige Lumpenpresselüge von den 20.000 und ihre unverschämte Hetze und ihr triefender Haß wird diesen Drecksblättern in den Orkus der verdienten Pleite verhelfen und der GEZ zum Tod durch Boykott, solche Systeme sind darauf angewiesen, daß max. 5% nicht mitmachen. Bei mir gibt es vor der Zwangsvollstreckung Widerspruch auf Widerspruch und für die Sudelpresse habe ich schon seit Jahren (2010?) keinen Pfennig mehr ausgegeben. Bringt sie zur Strecke!

    • Avatar
      Nichts ist für die Ewigkeit am

      Wer Hass sät erntet den Sturm ! Auch dieses Gesindel ist einmal dran und dann gibts keine Gnade.

  12. Avatar

    Who the fuck ist Bild?
    Wie hoch ist deren derzeitige Auflage?
    Auf jeden Fall ist die Auflage seit Jahren im permanenten Sturzflug.

    Der 01.08.2020 war das Waterloo des öffentlich-rechtlich subventionierten Staatsfunks.

    • Avatar

      Wagner lügt. Die Polente konnte die Demo gar nicht auflösen, dazu war sie mit 1100 Mann viel zu schwach.Ein Staatsversagen und totale Blamage ,wird einfach uner den Teppich gekehrt.

      • Avatar

        Ach was, "Covidioten" sind Lemminge. Ein Machtwort von dir hätte genügt, um sie vom Platz zu fegen.

Bitte beachten Sie unsere Kommentarregeln. Kommentare sind nur innerhalb von 24 h nach Veröffentlichung des Artikels möglich.

Empfehlen Sie diesen Artikel